Haplogroup R2

Haplogroup R2
Possible time of origin 28,200 ybp
Possible place of origin South Asia
Ancestor Haplogroup R
Descendants Haplogroup R2a
Defining mutations M479
Highest frequencies South Asia

Haplogroup R2, or haplogroup R-M479, is a Y-chromosome haplogroup characterized by genetic marker M479. It has been concentrated geographically in South Asia since prehistoric times.

Subclades

Haplogroup R2
Paragroup R-M479*

  Haplogroup R2a

 



Paragroup R-M479*

Paragroup is a term used in population genetics to describe lineages within a haplogroup that are not defined by any additional unique markers. They are typically represented by an asterisk (*) placed after the main haplogroup.

Y-chromosomes which are positive to the M479 SNP and negative to the M124, P249, P267, L266, PAGES00004, and L381 SNPs, are categorized as belonging to Paragroup R-M479*. It should be noted that exclusive studies have not been done to determine frequency or presence of R-M479* and figures below are not indicative of R-M479* frequency, especially within South Asia since Pakistan is the only South Asian country included within the referenced study.

Frequency of Paragroup R-M479* (M479+, M124-)
Count Sample size R-M479* Frequency
Portugal, Lisbon 1 100 0.010
Andalusia, Sevilla 1 127 0.008
Bashkirs (Bashkortostan, Russia) 1 39 0.026
Italy North 1 124 0.008
Ossetian South (South Caucasus) 1 23 0.043
Pakistan North 6 85 0.071

Haplogroup R-M124

Haplogroup R-M124 is a Y-chromosome haplogroup characterized by genetic markers L266, M124, P249, and P267, and is mainly found in South Asia and southern Central Asia.

Haplogroup R2 is a subgroup of Haplogroup R (M207):

Description of the M479 SNP

Common Name Marker M479
YCC Haplogroup R-M479
Nucleotide change C to T
Amplicon size (bp) reference sequence 323
Polymorphism position from 5' end 107
Restriction enzyme variant HphI
RefSNP ID -
Y-position 19294055
Primer forward 5'-3' gatactttatcaggcttacttc
Primer reverse 5'-3' aaccaaatctctcagaatcg

Notes

    See also

    Y-DNA R-M207 subclades

    Y-DNA backbone tree

    Phylogenetic tree of human Y-chromosome DNA haplogroups [χ 1][χ 2]
    "Y-chromosomal Adam"
    A00 A0-T [χ 3]
    A0 A1 [χ 4]
    A1a A1b
    A1b1 BT
    B CT
    DE CF
    D E C F
    F1  F2  F3  GHIJK
    G HIJK
    IJK H
    IJ   K
    I J    LT [χ 5]  K2
    L T [χ 6] NO [χ 7] K2b [χ 8]     K2c  K2d  K2e [χ 9]
    N   O   K2b1 [χ 10]     P
    K2b1a[χ 11]     K2b1b K2b1c      M     P1 P2
    K2b1a1   K2b1a2   K2b1a3 S [χ 12] Q   R
    1. ↑ Van Oven M, Van Geystelen A, Kayser M, Decorte R, Larmuseau HD (2014). "Seeing the wood for the trees: a minimal reference phylogeny for the human Y chromosome". Human Mutation. 35 (2): 187–91. doi:10.1002/humu.22468. PMID 24166809.
    2. ↑ International Society of Genetic Genealogy (ISOGG; 2015), Y-DNA Haplogroup Tree 2015. (Access date: 1 February 2015.)
    3. ↑ Haplogroup A0-T is also known as A0'1'2'3'4.
    4. ↑ Haplogroup A1 is also known as A1'2'3'4.
    5. ↑ Haplogroup LT (L298/P326) is also known as Haplogroup K1.
    6. ↑ Between 2002 and 2008, Haplogroup T (M184) was known as "Haplogroup K2" – that name has since been re-assigned to K-M526, the sibling of Haplogroup LT.
    7. ↑ Haplogroup NO (M214) is also known as Haplogroup K2a (although the present Haplogroup K2e was also previously known as "K2a").
    8. ↑ Haplogroup K2b (M1221/P331/PF5911) is also known as Haplogroup MPS.
    9. ↑ Haplogroup K2e (K-M147) was previously known as "Haplogroup X" and "K2a" (but is a sibling subclade of the present K2a, also known as Haplogroup NO).
    10. ↑ Haplogroup K2b1 (P397/P399) is similar to the former Haplogroup MS, but has a broader and more complex internal structure.
    11. ↑ Haplogroup K2b1a has also been known as Haplogroup S-P405.
    12. ↑ Haplogroup S (S-M230), also known as K2b1a4, was previously known as Haplogroup K5.
    This article is issued from Wikipedia - version of the 7/30/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.